View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2858_low_25 (Length: 243)
Name: NF2858_low_25
Description: NF2858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2858_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 18255996 - 18256215
Alignment:
| Q |
18 |
aggaggaagttgttgggattataactttggaagatgtcatggaagagctacttcaggttagtcttacttcctatcatagtacaataatttttgttcgtct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
18255996 |
aggaggaagttgttgggattataactttggaagatgtcatggaagagctacttcaggttagtcttacttcctatcatagtacaataatttttgttcatct |
18256095 |
T |
 |
| Q |
118 |
tcagaccctctgtaaaatgtgtgtcgagtcgcgtggatcatactctttttagggtaaaactcctttttgagccgannnnnnnnattcacaagactcaaac |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18256096 |
tcagaccctctgtaaaatgtgtgtcgagtcgcgtggatcatactctttttagggtaaaactcctttttgagccgattttttctattcacaagactcaaac |
18256195 |
T |
 |
| Q |
218 |
ttaaattttattgaaaagat |
237 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
18256196 |
ttaagttttattgaaaagat |
18256215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University