View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2858_low_27 (Length: 239)
Name: NF2858_low_27
Description: NF2858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2858_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 32470993 - 32471142
Alignment:
| Q |
1 |
ttgctggcttcaaattataaagctatattagcatgctaat-ttgtttgtattttacttattgtaaattttgagaacaaaaactagggcatttgcaactcc |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32470993 |
ttgctggctgcaaattataaagctatattagcatgctactcttgtttgtattttacttattgtaaattttgagaacaaaaactagggcatttgcaactcc |
32471092 |
T |
 |
| Q |
100 |
ctttctgtcaaaaaataaaggattcaaacaatgatgatagattaatggtt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32471093 |
ctttctgtcaaaaaataaaggattcaaacaatgatgatagattaatggtt |
32471142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University