View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2859-Insertion-22 (Length: 161)
Name: NF2859-Insertion-22
Description: NF2859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2859-Insertion-22 |
 |  |
|
| [»] scaffold0072 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0072 (Bit Score: 86; Significance: 2e-41; HSPs: 1)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 86; E-Value: 2e-41
Query Start/End: Original strand, 39 - 161
Target Start/End: Complemental strand, 15018 - 14894
Alignment:
| Q |
39 |
agttgaactatatatgttcaatgaatttggtcccctataatgttaaattcttgactaaccacatgca--nnnnnnnngtgtaacataacatgtgagattc |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15018 |
agttgaactatatatgttcaatgaatttggtcccctataatgttaaattcttgactaaccacatgcattttttttgtgtgtaacataacatgtgagattc |
14919 |
T |
 |
| Q |
137 |
cattggatatcgactgcgtggctca |
161 |
Q |
| |
|
||||||||||||||||| ||||||| |
|
|
| T |
14918 |
cattggatatcgactgcatggctca |
14894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University