View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2859-Insertion-25 (Length: 70)
Name: NF2859-Insertion-25
Description: NF2859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2859-Insertion-25 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 60; Significance: 2e-26; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 2e-26
Query Start/End: Original strand, 7 - 70
Target Start/End: Complemental strand, 1926038 - 1925975
Alignment:
| Q |
7 |
acatatatgattacattgaattatgtcccttttcaaactattatcggtattgacgtatcgtgtt |
70 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1926038 |
acatatatgattacattgaattatgtcctttttcaaactattatcggtattgacgtatcgtgtt |
1925975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 49
Target Start/End: Original strand, 4672381 - 4672416
Alignment:
| Q |
14 |
tgattacattgaattatgtcccttttcaaactatta |
49 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4672381 |
tgattacattcaattatgtcccttttcaaactatta |
4672416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 54
Target Start/End: Original strand, 7803427 - 7803472
Alignment:
| Q |
10 |
tatatgattacattgaattatgtc-ccttttcaaactattatcggt |
54 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
7803427 |
tatatgattatattgaattatgtcatcttttcaaactattatcggt |
7803472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 65
Target Start/End: Complemental strand, 31026746 - 31026687
Alignment:
| Q |
7 |
acatatatgattacattgaattatgtcccttt-tcaaactattatcggtattgacgtatc |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||| | ||| |||||||||| | |||||||| |
|
|
| T |
31026746 |
acatatatgattacattgaattatgtcattttcttaaattattatcggtctcgacgtatc |
31026687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 28; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 62
Target Start/End: Complemental strand, 37318459 - 37318408
Alignment:
| Q |
11 |
atatgattacattgaattatgtcccttttcaaactattatcggtattgacgt |
62 |
Q |
| |
|
||||||||||||||||||| |||| |||| ||| ||||||| || ||||||| |
|
|
| T |
37318459 |
atatgattacattgaattacgtccttttttaaattattatcagtgttgacgt |
37318408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University