View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2859-Insertion-31 (Length: 124)
Name: NF2859-Insertion-31
Description: NF2859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2859-Insertion-31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 4e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 4e-39
Query Start/End: Original strand, 16 - 113
Target Start/End: Original strand, 40023293 - 40023389
Alignment:
| Q |
16 |
attattagcacacattttggttcatgtgtgtcgtcgtaaccctagctcccctttgtcaccaaaatatgatcgatggtagcctatgtcatacccttctt |
113 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
40023293 |
attattaggacacattttggttcatgtgtgtcgtcgtaaccctagctcccctttgtcaccaaaata-gatcgatggtagcctatgtcataaccttctt |
40023389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University