View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2859R-Insertion-8 (Length: 513)
Name: NF2859R-Insertion-8
Description: NF2859R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2859R-Insertion-8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 441 - 499
Target Start/End: Original strand, 13820225 - 13820283
Alignment:
| Q |
441 |
acacatgttggtgaagttgttggaacgagtcatctatcgaaaccaccttacattaccat |
499 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13820225 |
acacatgttggtgaagttgttggaacgagtcatctatggaaaccaccttacattaccat |
13820283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 332 - 360
Target Start/End: Complemental strand, 22600476 - 22600448
Alignment:
| Q |
332 |
ccttgcatatattatgcattattcaaact |
360 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22600476 |
ccttgcatatattatgcattattcaaact |
22600448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University