View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2859_high_11 (Length: 216)
Name: NF2859_high_11
Description: NF2859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2859_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 17 - 201
Target Start/End: Complemental strand, 46152657 - 46152473
Alignment:
| Q |
17 |
cacagaaatgcaggaacaaagtaaaacaaaccaaagatggagagtgaggaataaccttaggtttagcaaaccatgatatagatttaaatgtagctaatct |
116 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46152657 |
cacagaaatgcaggaacaaagtataacaaacaaaagatggagagtgaggaataaccttaggtttagcaaaccatgatatagatttaaatgtagctaatct |
46152558 |
T |
 |
| Q |
117 |
cctcataaaatcagcacgatcccacggtctacacaaatgtccttgggattctgatactgctgtagctgataagtactgttcatcc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46152557 |
cctcataaaatcagcacgatcccacggtctacacaaatgtccttgggattctgatactgctgtagctgataagtactgttcatcc |
46152473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University