View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2859_low_6 (Length: 324)
Name: NF2859_low_6
Description: NF2859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2859_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 61 - 323
Target Start/End: Complemental strand, 43566551 - 43566278
Alignment:
| Q |
61 |
aatttactcttttatattatcgaaagcaggttgttgtgtgggatcaatcaagttacaaagggcaaaatagcaaaaaggnnnnnnnnnnta--------tc |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
43566551 |
aatttactcttttatattatcgaaagcaggttgttgtgtgggatcaatcaagttacaaagggcaaaatagcaaaaaggaaaacaaaaagaaaaaaaaatc |
43566452 |
T |
|
| Q |
153 |
ccatataagtgcacactctcccttaaccctaacaatatcactctctcat---gcgttcttcactttcaaacaaactcaatgaattcaatggttgatggta |
249 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43566451 |
ccatataaatgcacactctcccttaaccctaacaatatcactctctcattgcgcgcccttcactttcaaacaaactcaatgaattcaatggttgatggta |
43566352 |
T |
|
| Q |
250 |
agaagaataaagttgaggggaagaatatctgccccaatctccaatgtcagatagatgaatacagaatgaagtta |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43566351 |
agaagaataaagttgaggggaagaatatctgccccaatctccaatgtcagatagatgaatacagaatgaagtta |
43566278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 202 - 324
Target Start/End: Original strand, 43473848 - 43473970
Alignment:
| Q |
202 |
gcgttcttcactttcaaacaaactcaatgaattcaatggttgatggtaagaagaataaagttgaggggaagaatatctgccccaatctccaatgtcagat |
301 |
Q |
| |
|
|||| ||||||||||||| ||| | | ||||||||||||||| | ||| ||| ||| |||||||| |||||||||||||||| ||||||||| ||||| |
|
|
| T |
43473848 |
gcgtccttcactttcaaataaattaagtgaattcaatggttggtagtaggaaaaatgaagttgagaggaagaatatctgccctaatctccaactccagat |
43473947 |
T |
|
| Q |
302 |
agatgaatacagaatgaagttac |
324 |
Q |
| |
|
||||||||| ||||||||||||| |
|
|
| T |
43473948 |
agatgaatatagaatgaagttac |
43473970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University