View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2859_low_8 (Length: 293)
Name: NF2859_low_8
Description: NF2859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2859_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 11 - 242
Target Start/End: Original strand, 19276917 - 19277149
Alignment:
| Q |
11 |
cacagaatcaatcaaaagccaaatcacctcaacaaaaggttttgttaatttaatataaacaactactagtactattatttgtttgtcactgttgtttagt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19276917 |
cacagaatcaatcaaaagccaaatcacctcaacaaaaggttttgttaatttaatgtaaacaactactagtactattatttgtttgtcactgttgtttagt |
19277016 |
T |
|
| Q |
111 |
taa--tctctctctctttttgtctcctaaaccaagacaatgtttggtctctttatatgctattattaactctctctctgcacaaaagaacaacacagatc |
208 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19277017 |
taatctctctctctctttttgtctcctaaaccaagacaatgtttggtctcttta-atgctattattaactctctctctgcacaaaagaacaacacagatc |
19277115 |
T |
|
| Q |
209 |
ccaacaactctcagaaaatcaagataacactgag |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
19277116 |
ccaacaactctcagaaaatcaagataacactgag |
19277149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University