View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2861_high_13 (Length: 255)
Name: NF2861_high_13
Description: NF2861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2861_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 242
Target Start/End: Complemental strand, 6990077 - 6989852
Alignment:
| Q |
17 |
aataataatctatattgattttacatgcaagtaagttgacnnnnnnnngcttaatgtaccattaatttttatacatgtgtattgattgatgttatgtact |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6990077 |
aataataatctatattgattttacatgcaagtaagttgacttttttttgcttaatgtaccattaatttttatacatgtgtattgattgatgttgtgtact |
6989978 |
T |
 |
| Q |
117 |
tgtgttgatatattttgtttcggacatgtctttgtgtatgtttggtttcggttccacgtttgaaaaatacaaaatcatttcgagattcatagaattgatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6989977 |
tgtgttgatatattttgtttcggacatgtctttgtgtatgtttggtttcggttccacgtttgaaaaatacaaaatcatttcgagattcatagaattgatt |
6989878 |
T |
 |
| Q |
217 |
tggacaaatttatatcctctcgagta |
242 |
Q |
| |
|
| |||| |||||||||||||||||| |
|
|
| T |
6989877 |
ttgacacgtttatatcctctcgagta |
6989852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University