View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2861_low_11 (Length: 318)
Name: NF2861_low_11
Description: NF2861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2861_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 13 - 172
Target Start/End: Original strand, 36515718 - 36515877
Alignment:
| Q |
13 |
acatcatcatcgttgtcgggtattccggcggcgagtcggaaaatggtacaaagcttgaaagagatagtttcgaatatacctgataacgagatctatgcca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36515718 |
acatcatcatcgttgtcgggtattccggcggcgagtcggaaaatggtacaaagcttgaaagagatagtttcgaatatacctgataacgagatctatgcca |
36515817 |
T |
|
| Q |
113 |
ctctcaaagactgtaacatggaccctaacgaagctgttagtcgtcttctttctcaaggtt |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36515818 |
ctctcaaagactgtaacatggaccctaacgaagctgttagtcgtcttctttctcaaggtt |
36515877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 207 - 298
Target Start/End: Original strand, 36515914 - 36516005
Alignment:
| Q |
207 |
atcactaacttatttagggtttttcaatttctttaactaatataacaatttactctttttcttcttgtagatccttttcatgaggttaagag |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36515914 |
atcactaacttatttagggtttttcaatttctttaattaatctaacaatttactctttttcttcttgtagatccttttcatgaggttaagag |
36516005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University