View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2861_low_15 (Length: 280)
Name: NF2861_low_15
Description: NF2861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2861_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 69; Significance: 5e-31; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 36948349 - 36948433
Alignment:
| Q |
20 |
ttatatgtgcttcttttccttccatcatcatcaactagcaaaccattgcggtacatttcctactacccctttcttgttctagcat |
104 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36948349 |
ttatatatgctccttttccttccatcatcatcaactagcataccattgcggtacatttcctactacccctttctttttctagcat |
36948433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 94
Target Start/End: Original strand, 36956425 - 36956499
Alignment:
| Q |
20 |
ttatatgtgcttcttttccttccatcatcatcaactagcaaaccattgcggtacatttcctactacccctttctt |
94 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||||| |
|
|
| T |
36956425 |
ttatatatgcttcttttccttccatcatcatcaactagcaagccattgcggtacatttctcactacccttttctt |
36956499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 36935569 - 36935629
Alignment:
| Q |
18 |
tgttatatgtgcttcttttccttccatcatcatcaactagcaaaccattgcggtacatttc |
78 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| || |||||||||||||| |
|
|
| T |
36935569 |
tgttatatgtgcttcttttccttccatcaccatcaactagcaaccccttgcggtacatttc |
36935629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 145 - 190
Target Start/End: Original strand, 36956625 - 36956670
Alignment:
| Q |
145 |
ttgtgtgtctattttgaccaatatgtatgtttatcttatcgtgtga |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36956625 |
ttgtgtgtctattttgaccaatatgtatgtttctcttatcgtgtga |
36956670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 44 - 104
Target Start/End: Complemental strand, 37066145 - 37066085
Alignment:
| Q |
44 |
tcatcatcaactagcaaaccattgcggtacatttcctactacccctttcttgttctagcat |
104 |
Q |
| |
|
|||||||||||||| ||| | ||||| ||||||||||||| ||||||||| ||||||||| |
|
|
| T |
37066145 |
tcatcatcaactagaaaatccttgcgatacatttcctactttccctttctttttctagcat |
37066085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 34 - 78
Target Start/End: Complemental strand, 12493385 - 12493341
Alignment:
| Q |
34 |
tttccttccatcatcatcaactagcaaaccattgcggtacatttc |
78 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12493385 |
tttccttccatcatcatcaactagcaagccattgcggtacatttc |
12493341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University