View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2861_low_24 (Length: 240)
Name: NF2861_low_24
Description: NF2861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2861_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 6989851 - 6989622
Alignment:
| Q |
1 |
gaatttagagctagaatttagtgtttttgactctacaattgattttcaatcttgaatttattgtttactcacttttatatttagatgaatgtattccaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6989851 |
gaatttagagctagaatttagtgtttttgactctacaattgattttcaatcttgaatttattgtttactcacttttatatttagatgaatgtattccaac |
6989752 |
T |
|
| Q |
101 |
ataaatgacgttttatatgtttgatatcacgtaggttttccgggtttagcgtttgcaaaatcatggtgtctcaatgtgatttcaacaaccccaacgtaat |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
6989751 |
ataaatgatgttttatatgtttgatatcacgtaggttttccgggtttagcgtttgcaaaatcatggtgtctcaacgtgatttcaacaaccccaccgtaat |
6989652 |
T |
|
| Q |
201 |
accaaacttttggcctatcttgttcctatg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6989651 |
accaaacttttggcctatcttgttcctatg |
6989622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 63
Target Start/End: Original strand, 4411276 - 4411334
Alignment:
| Q |
5 |
ttagagctagaatttagtgtttttgactctacaattgattttcaatcttgaatttattg |
63 |
Q |
| |
|
||||||||||||||| | | ||||| |||||||||||||||| | ||||||||||||| |
|
|
| T |
4411276 |
ttagagctagaattttgagcttttgcctctacaattgatttttagccttgaatttattg |
4411334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University