View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2864_low_3 (Length: 242)
Name: NF2864_low_3
Description: NF2864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2864_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 23070549 - 23070775
Alignment:
| Q |
1 |
atacggtaatggttgtctaaaaaattcaggnnnnnnnnctatatcatataataagtgggtcattgctcttttggcctcatatttgctcattatcttgaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23070549 |
atacggtaatggttgtctaaaaaattcaggttttttt--tatatcatataataagtgggtcattgctcttttggccccatatttgctcattatcttgaaa |
23070646 |
T |
 |
| Q |
101 |
aacaatcttcaaaagttatcaatcgaaattttt-nnnnnnnnnnnnntgtcgttcgagagtaatctctccaaaaacaatctttaaaagttatcacttgaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |||||||||||| ||| |
|
|
| T |
23070647 |
aacaatcttcaaaagttatcaatcgaaatttttaaaaaacaaaaaaatgtcgttcgagagtaatctctccaaaaacaatatttgaaagttatcactcgaa |
23070746 |
T |
 |
| Q |
200 |
gtctctaataagtgctcggtttgaatctg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23070747 |
gtctctaataagtgctcggtttgaatctg |
23070775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 80 - 120
Target Start/End: Original strand, 36848235 - 36848275
Alignment:
| Q |
80 |
tatttgctcattatcttgaaaaacaatcttcaaaagttatc |
120 |
Q |
| |
|
||||||||| ||||| ||||||||||| ||||||||||||| |
|
|
| T |
36848235 |
tatttgctctttatcctgaaaaacaattttcaaaagttatc |
36848275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 120
Target Start/End: Complemental strand, 36940322 - 36940264
Alignment:
| Q |
62 |
attgctcttttggcctcatatttgctcattatcttgaaaaacaatcttcaaaagttatc |
120 |
Q |
| |
|
||||||||||||||| | ||||||||| ||||| ||||||| || |||||| ||||||| |
|
|
| T |
36940322 |
attgctcttttggccgcctatttgctctttatcctgaaaaataaccttcaagagttatc |
36940264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University