View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2864_low_4 (Length: 231)
Name: NF2864_low_4
Description: NF2864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2864_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 215
Target Start/End: Original strand, 47193898 - 47194106
Alignment:
| Q |
7 |
catcatcatcgaatggtgagttgggtgatggaaaaggtgaaaagtgcacctacgactatgttttggattgaagagattgttgatggtaatttggaaggaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47193898 |
catcatcatcgaatggtgagttgggtgatggaaaaggtgaaaagtgcacctacgactatgttttggattgaagagattgttgatggtaatttggaaggaa |
47193997 |
T |
|
| Q |
107 |
aatatgatgttaatcaggttgagaatttggttaaagtggctttgatgtgtgtgaaagatgacatgaatgaaagaccatccatgagtcaagtagtggagat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47193998 |
aatatgatgttaatcaggttgagaatttggttaaagtggctttgatgtgtgtgaaagatgacatgaatgaaagaccatccatgagtcaagtagtggagat |
47194097 |
T |
|
| Q |
207 |
gcttcttca |
215 |
Q |
| |
|
||||||||| |
|
|
| T |
47194098 |
gcttcttca |
47194106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University