View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2864_low_5 (Length: 210)
Name: NF2864_low_5
Description: NF2864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2864_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 35 - 194
Target Start/End: Original strand, 21800503 - 21800662
Alignment:
| Q |
35 |
tagaccctgagaaatcataatattatcatccttaccgttatgtcgagtatgcttgtattctaagcccttttggttatctagtgcctcatctgcattaaaa |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21800503 |
tagaccctgagaaatcataatattatcatccttaccgttatgtcgagtatccttgtattctaagcccttttggttatctagtgcctcatctgcattaaaa |
21800602 |
T |
 |
| Q |
135 |
ccaattaggtaaaataaaagtgaataatgtatggttctattttaagttgtgtgtgtacac |
194 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21800603 |
ccaattagataaaataaaagtgaataatgtatggttctattttaagttgtgtgtgtacac |
21800662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University