View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2865-Insertion-12 (Length: 134)
Name: NF2865-Insertion-12
Description: NF2865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2865-Insertion-12 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 90; Significance: 7e-44; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 7e-44
Query Start/End: Original strand, 8 - 134
Target Start/End: Complemental strand, 22927048 - 22926922
Alignment:
| Q |
8 |
gttttagtcttaataattcgtttggttgaaattaagtcattggtatccatgggaaaattattttaagtnnnnnnngtagtgaagaaattgtataaatatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22927048 |
gttttagtcttaataattcgtttggttgaaattaagtcattggtatccatgggaaaattatttttttaaaaaaaagtagtgaagaaattgtataaatatt |
22926949 |
T |
|
| Q |
108 |
cttcaatttctatttgtgcagtatatg |
134 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
22926948 |
cttcaatttctatttgtgcagtatatg |
22926922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University