View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2865-Insertion-13 (Length: 78)

Name: NF2865-Insertion-13
Description: NF2865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2865-Insertion-13
NF2865-Insertion-13
[»] chr7 (2 HSPs)
chr7 (8-74)||(30120464-30120530)
chr7 (8-78)||(30124105-30124176)
[»] chr5 (1 HSPs)
chr5 (8-78)||(29261102-29261172)


Alignment Details
Target: chr7 (Bit Score: 63; Significance: 4e-28; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 8 - 74
Target Start/End: Original strand, 30120464 - 30120530
Alignment:
8 gattccatagatagaagcctttgtcagagtgcagaaacacaaaccccctgcatgaacctccgatttg 74  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
30120464 gattccatagatagaagcctttgtcagagtgcaaaaacacaaaccccctgcatgaacctccgatttg 30120530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 78
Target Start/End: Original strand, 30124105 - 30124176
Alignment:
8 gattccatagatagaagcctttgtcagagtgcagaaa-cacaaaccccctgcatgaacctccgatttgagga 78  Q
    |||||||||  ||||||||||||||||| |||| ||| |||||||||||| || ||||||||||||||||||    
30124105 gattccataactagaagcctttgtcagactgcaaaaaacacaaaccccctacacgaacctccgatttgagga 30124176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 63; Significance: 4e-28; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 8 - 78
Target Start/End: Complemental strand, 29261172 - 29261102
Alignment:
8 gattccatagatagaagcctttgtcagagtgcagaaacacaaaccccctgcatgaacctccgatttgagga 78  Q
    ||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||    
29261172 gattccatagatagaagcctttgtcagagtgcaaaaacacaaaccctctgcatgaacctccgatttgagga 29261102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University