View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2865-Insertion-13 (Length: 78)
Name: NF2865-Insertion-13
Description: NF2865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2865-Insertion-13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 63; Significance: 4e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 8 - 74
Target Start/End: Original strand, 30120464 - 30120530
Alignment:
| Q |
8 |
gattccatagatagaagcctttgtcagagtgcagaaacacaaaccccctgcatgaacctccgatttg |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30120464 |
gattccatagatagaagcctttgtcagagtgcaaaaacacaaaccccctgcatgaacctccgatttg |
30120530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 78
Target Start/End: Original strand, 30124105 - 30124176
Alignment:
| Q |
8 |
gattccatagatagaagcctttgtcagagtgcagaaa-cacaaaccccctgcatgaacctccgatttgagga |
78 |
Q |
| |
|
||||||||| ||||||||||||||||| |||| ||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
30124105 |
gattccataactagaagcctttgtcagactgcaaaaaacacaaaccccctacacgaacctccgatttgagga |
30124176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 4e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 8 - 78
Target Start/End: Complemental strand, 29261172 - 29261102
Alignment:
| Q |
8 |
gattccatagatagaagcctttgtcagagtgcagaaacacaaaccccctgcatgaacctccgatttgagga |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29261172 |
gattccatagatagaagcctttgtcagagtgcaaaaacacaaaccctctgcatgaacctccgatttgagga |
29261102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University