View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2865R-Insertion-3 (Length: 242)
Name: NF2865R-Insertion-3
Description: NF2865R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2865R-Insertion-3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 9 - 226
Target Start/End: Original strand, 33112414 - 33112634
Alignment:
| Q |
9 |
ccaaacggtggtttgtttctcaatttccaaagaaccaattcaccac---caccacctcaacctctttcacaatggaaggtggagtacataagcctgatat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
33112414 |
ccaaacggtggtttgtttctcaatttccaaagaaccaattcaccacaaccaccacctcaacctctttcaaaatggaaggtgaagtacataagcctgatat |
33112513 |
T |
|
| Q |
106 |
ctcagcttttagagaatgtctttccctttcatggaaaaatccttatgtccttcgtcttgctttttctgctggtattggtggctttctctttggctacgat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33112514 |
atcagcttttagagaatgtctttccctttcatggaaaaatccttatgtccttcgtcttgctttttctgctggtattggtggccttctctttggctacgac |
33112613 |
T |
|
| Q |
206 |
actggtaattacactacaacc |
226 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
33112614 |
actggtaattacactacaacc |
33112634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 150 - 198
Target Start/End: Original strand, 33110888 - 33110936
Alignment:
| Q |
150 |
atgtccttcgtcttgctttttctgctggtattggtggctttctctttgg |
198 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
33110888 |
atgtccttcgacttgctttctctgctggtattggtggccttctctttgg |
33110936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 77 - 124
Target Start/End: Original strand, 33110829 - 33110876
Alignment:
| Q |
77 |
atggaaggtggagtacataagcctgatatctcagcttttagagaatgt |
124 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
33110829 |
atggaaggtggagtaccagaggctgatatctcagcttttagagaatgt |
33110876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 76 - 214
Target Start/End: Complemental strand, 21562911 - 21562773
Alignment:
| Q |
76 |
aatggaaggtggagtacataagcctgatatctcagcttttagagaatgtctttccctttcatggaaaaatccttatgtccttcgtcttgctttttctgct |
175 |
Q |
| |
|
||||||||| ||||||| | | ||||| | || ||||| ||||||||| | || || |||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
21562911 |
aatggaaggaggagtacctgaagctgatgtatctgctttcagagaatgtttgtctctatcatggaaaaatccttatgttcttcgtcttgctttctctgct |
21562812 |
T |
|
| Q |
176 |
ggtattggtggctttctctttggctacgatactggtaat |
214 |
Q |
| |
|
|| |||||||| |||||||||||||| |||||||||||| |
|
|
| T |
21562811 |
ggaattggtggttttctctttggctatgatactggtaat |
21562773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 101 - 213
Target Start/End: Complemental strand, 21496836 - 21496724
Alignment:
| Q |
101 |
gatatctcagcttttagagaatgtctttccctttcatggaaaaatccttatgtccttcgtcttgctttttctgctggtattggtggctttctctttggct |
200 |
Q |
| |
|
||||| || ||||| ||||||||| | || || |||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||| ||||||| |
|
|
| T |
21496836 |
gatatgtctgctttcagagaatgtttatctctatcatggaaaaatccttatgttcttcgtcttgctttttctgctggaattggtggccttctttttggct |
21496737 |
T |
|
| Q |
201 |
acgatactggtaa |
213 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
21496736 |
atgatactggtaa |
21496724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 134 - 203
Target Start/End: Original strand, 51032218 - 51032287
Alignment:
| Q |
134 |
tcatggaaaaatccttatgtccttcgtcttgctttttctgctggtattggtggctttctctttggctacg |
203 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||| |||||||||| |
|
|
| T |
51032218 |
tcatggaaaaatccttatgttcttcgtcttgctttttctgctggaattggtggacttctttttggctacg |
51032287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University