View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2865_low_7 (Length: 260)
Name: NF2865_low_7
Description: NF2865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2865_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 254
Target Start/End: Original strand, 5831399 - 5831625
Alignment:
| Q |
17 |
aaatcatcgtcatggatgactctgccatagattcacttccacgatggcaaaaagcgcaagggaacttttctatagcactccatgtttgcagtataaaata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5831399 |
aaatcatcgtcatggatgactctgccatagattcacttccacgatggcaaaaagcgcaagggaacttttc-----------atgtttgcagtataaaata |
5831487 |
T |
|
| Q |
117 |
atatataccaattaggaaggggacaaaacatcacatattcacctattggtggagagggtcatatttgattcctctattgtaactcacatcacattgaaag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5831488 |
atatataccaattaggaaggggacaaaacatcacatattcacctattggtggagagggtcgtatttgattcctctattgtaactcacatcacattgaaag |
5831587 |
T |
|
| Q |
217 |
taagtcttgtattacatgggttttgtaattcatttcag |
254 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5831588 |
taagtcttgtattacatgggttttgtaactcatttcag |
5831625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University