View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2866_high_3 (Length: 238)
Name: NF2866_high_3
Description: NF2866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2866_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 225
Target Start/End: Original strand, 39474023 - 39474231
Alignment:
| Q |
17 |
aatatattgataagagtgttttctaatagaatctgatgatgacctgttttcatatttttactagattgcagtagaaaatggtgtgattttaaacatatct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39474023 |
aatatattgataagagtgttttctaatagaatctgatgatgacctgttttcatatttttactagattgcagtagaaaatggtgtgattttaaacatatct |
39474122 |
T |
 |
| Q |
117 |
gcttttttgatttggttgatgctgaaagtgagttttgaatctcagactaatgtttataaacttcatgtttattacagaagatgcactatatgcattgaag |
216 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39474123 |
gctcttttgatttggttgatgctgaaagtgagttttgaatctcagactaatgtttataaacttcatgtttattacagaagatgcactatatgcattgaag |
39474222 |
T |
 |
| Q |
217 |
ttatctctg |
225 |
Q |
| |
|
||||||||| |
|
|
| T |
39474223 |
ttatctctg |
39474231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University