View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2866_low_4 (Length: 238)
Name: NF2866_low_4
Description: NF2866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2866_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 50111976 - 50111801
Alignment:
| Q |
1 |
ttatatcatatcactgtgctgcattgcattgcatattcaattttactattttaattagtatgaattaaaaccgagctttaaagtgtaccgaaatcagggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50111976 |
ttatatcatatcactgtgctgcattgcattgcatattcaattttactattttaattagtatgaattaaaaccgagctttaaagtgtaccgaaatcagggt |
50111877 |
T |
 |
| Q |
101 |
gacacactgttatttcgacaaacttgaacatatccatggtgtacataaatgcatttcagaatgcagttggtcatac |
176 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50111876 |
gacacactgtgatttcgacaaacttgaacatatccatggtgtacataaatgcatttcagaatgcagttggtcatac |
50111801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University