View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2867_high_10 (Length: 332)

Name: NF2867_high_10
Description: NF2867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2867_high_10
NF2867_high_10
[»] chr7 (2 HSPs)
chr7 (3-324)||(43396918-43397239)
chr7 (126-174)||(3499398-3499446)
[»] chr5 (1 HSPs)
chr5 (69-112)||(40086943-40086986)
[»] chr1 (1 HSPs)
chr1 (193-221)||(6495524-6495552)


Alignment Details
Target: chr7 (Bit Score: 306; Significance: 1e-172; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 3 - 324
Target Start/End: Original strand, 43396918 - 43397239
Alignment:
3 tctagctttgtttcttggaccgccgaaaaatccaccttatgctaaaaggggtggtgaaaatccaccttgggtgttgtggaaagctagaaatggtaaaatt 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
43396918 tctagctttgtttcttggaccgccgaaaaatccaccttatgctaaaaggggtggtgaaaatccaccttgggtgttgtggaaagctagaaatggtaaattt 43397017  T
103 tttaatgaaaccaattttgaggtggatgagctagtggaggaaatcaaggttatgtcttggcggtggttgttgcatcatacgaagattccggtttgccttt 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||    
43397018 tttaatgaaaccaattttgaggtggatgagctagtggaggaaatcaaggttatgtcttggcggtggttgttgcatggtacgaagattccggtttgccttt 43397117  T
203 actacgaatggtgttggaatccctatgtttgtcttgaaagggaaaggctgcgcgcctagcttcagttgtagttgtctgaggccggttctggtgtgtcgtg 302  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43397118 actacgaatggtgttggaatccctatgcttgtcttgaaagggaaaggctgcgcgcctagcttcagttgtagttgtctgaggccggttctggtgtgtcgtg 43397217  T
303 agcctgctgtcgtgtctctgct 324  Q
    ||||||||||||||||||||||    
43397218 agcctgctgtcgtgtctctgct 43397239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 126 - 174
Target Start/End: Complemental strand, 3499446 - 3499398
Alignment:
126 ggatgagctagtggaggaaatcaaggttatgtcttggcggtggttgttg 174  Q
    ||||||||||||| |||| |||||||| ||||||||| ||| |||||||    
3499446 ggatgagctagtgaaggagatcaaggtgatgtcttggaggtcgttgttg 3499398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 69 - 112
Target Start/End: Original strand, 40086943 - 40086986
Alignment:
69 ttgggtgttgtggaaagctagaaatggtaaaatttttaatgaaa 112  Q
    |||||| |||||||||||||| |||| |||||||||||||||||    
40086943 ttgggtattgtggaaagctaggaatgataaaatttttaatgaaa 40086986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 193 - 221
Target Start/End: Original strand, 6495524 - 6495552
Alignment:
193 gtttgcctttactacgaatggtgttggaa 221  Q
    |||||||||||||||||||||||||||||    
6495524 gtttgcctttactacgaatggtgttggaa 6495552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University