View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2867_high_15 (Length: 250)
Name: NF2867_high_15
Description: NF2867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2867_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 49 - 185
Target Start/End: Complemental strand, 25817087 - 25816947
Alignment:
| Q |
49 |
agaattatattctaatgatcaaggcatgatccattgttttaggtcatatata----ggttcaaattccattgtttatggaatgatatttgacattgtccg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25817087 |
agaattatattctaatgatcaaggcatgatccattcttttaggtcatatatatataggttcagattccattgtttttggaatgatatttgacattgtccg |
25816988 |
T |
 |
| Q |
145 |
tcagtttacacggttttatacggtcatccagaccaaacata |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25816987 |
tcagtttacacggttttatacggtcatccagaccaaacata |
25816947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University