View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2867_high_7 (Length: 348)
Name: NF2867_high_7
Description: NF2867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2867_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 40859090 - 40859315
Alignment:
| Q |
1 |
gcgtatgtacctagacactatgcattttgttttgtgaccatacaaaaattctctaacacttatgcctaatatccttcaatgtgtatgaatgtcatcaacg |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||| | |||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40859090 |
gcgtatgtgcctagacactatgcattttgtttagtgaccatacaaaaattatgtaacgcttattcctaatatccttcaatgtgtatgaatgtcatcaacg |
40859189 |
T |
 |
| Q |
101 |
ctgtcgtggttcaacattgcatgcaaaatttaattttattcaaaatttgacaaaatgactaacaaacaaaggggaaattgg-------taaatattatta |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40859190 |
ctgtcgtggttcaacattgcatgcaaaatttaattttgttcaaaatttgacaaaatgactaacaaacaaaggggaaattggtaaatattaaatattatta |
40859289 |
T |
 |
| Q |
194 |
tgttttgattggcaatgaaaaataag |
219 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40859290 |
tgttttgattggcaatgaaaaataag |
40859315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 337
Target Start/End: Original strand, 40859407 - 40859436
Alignment:
| Q |
308 |
gaagttggaattcgaactgtcaactttctt |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40859407 |
gaagttggaattcgaactgtcaactttctt |
40859436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University