View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2867_low_10 (Length: 332)
Name: NF2867_low_10
Description: NF2867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2867_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 306; Significance: 1e-172; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 3 - 324
Target Start/End: Original strand, 43396918 - 43397239
Alignment:
| Q |
3 |
tctagctttgtttcttggaccgccgaaaaatccaccttatgctaaaaggggtggtgaaaatccaccttgggtgttgtggaaagctagaaatggtaaaatt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43396918 |
tctagctttgtttcttggaccgccgaaaaatccaccttatgctaaaaggggtggtgaaaatccaccttgggtgttgtggaaagctagaaatggtaaattt |
43397017 |
T |
|
| Q |
103 |
tttaatgaaaccaattttgaggtggatgagctagtggaggaaatcaaggttatgtcttggcggtggttgttgcatcatacgaagattccggtttgccttt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43397018 |
tttaatgaaaccaattttgaggtggatgagctagtggaggaaatcaaggttatgtcttggcggtggttgttgcatggtacgaagattccggtttgccttt |
43397117 |
T |
|
| Q |
203 |
actacgaatggtgttggaatccctatgtttgtcttgaaagggaaaggctgcgcgcctagcttcagttgtagttgtctgaggccggttctggtgtgtcgtg |
302 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43397118 |
actacgaatggtgttggaatccctatgcttgtcttgaaagggaaaggctgcgcgcctagcttcagttgtagttgtctgaggccggttctggtgtgtcgtg |
43397217 |
T |
|
| Q |
303 |
agcctgctgtcgtgtctctgct |
324 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
43397218 |
agcctgctgtcgtgtctctgct |
43397239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 126 - 174
Target Start/End: Complemental strand, 3499446 - 3499398
Alignment:
| Q |
126 |
ggatgagctagtggaggaaatcaaggttatgtcttggcggtggttgttg |
174 |
Q |
| |
|
||||||||||||| |||| |||||||| ||||||||| ||| ||||||| |
|
|
| T |
3499446 |
ggatgagctagtgaaggagatcaaggtgatgtcttggaggtcgttgttg |
3499398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 69 - 112
Target Start/End: Original strand, 40086943 - 40086986
Alignment:
| Q |
69 |
ttgggtgttgtggaaagctagaaatggtaaaatttttaatgaaa |
112 |
Q |
| |
|
|||||| |||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
40086943 |
ttgggtattgtggaaagctaggaatgataaaatttttaatgaaa |
40086986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 193 - 221
Target Start/End: Original strand, 6495524 - 6495552
Alignment:
| Q |
193 |
gtttgcctttactacgaatggtgttggaa |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6495524 |
gtttgcctttactacgaatggtgttggaa |
6495552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University