View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2867_low_12 (Length: 305)
Name: NF2867_low_12
Description: NF2867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2867_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 290
Target Start/End: Complemental strand, 31951189 - 31950900
Alignment:
| Q |
1 |
attttacctaacaatattttcttcttcatattaatgcaggttctgttaggaatgtatattttccatttgatattctcactgatactcccattgatgttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31951189 |
attttacctaacaatattttcttcttcatattaatgcaggttctgttaggaatgtatattttccatttgatattctcactgatactcccattgatgttgc |
31951090 |
T |
 |
| Q |
101 |
aatggagatggtaaaagaattggagatttctgattgggatccttttgatattgcaaatatgatcaatagagagatatctgctcttctaccacatagatgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31951089 |
aatggagatggtaaaagaattggagatttctgattgggatccttttgatattgcaaatatgatcaatagagagatatctgctcttctaccacatagatgg |
31950990 |
T |
 |
| Q |
201 |
aaaaatgattactcagattctttccatacattcagttatcaagatgatgatgtcgatgaatctcgtcttcatttccgctcgatctcttct |
290 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31950989 |
aaaaatgattactcagattccttccatacattcagttatcaagatgatgatgtcgatgaatctcgtcttcatttccgctcgatctcttct |
31950900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 35 - 163
Target Start/End: Complemental strand, 5951002 - 5950874
Alignment:
| Q |
35 |
tgcaggttctgttaggaatgtatattttccatttgatattctcactgatactcccattgatgttgcaatggagatggtaaaagaattggagatttctgat |
134 |
Q |
| |
|
||||||||||| ||||||||||||||| || ||||| ||| ||||||| || || ||||||||||| | ||||||||||||||| ||||| || | || |
|
|
| T |
5951002 |
tgcaggttctgctaggaatgtatatttcccctttgacattttcactgacaccccaattgatgttgcgaaggagatggtaaaagagttggacatcacaaat |
5950903 |
T |
 |
| Q |
135 |
tgggatccttttgatattgcaaatatgat |
163 |
Q |
| |
|
|||||||||| ||| ||||| | |||||| |
|
|
| T |
5950902 |
tgggatccttctgaaattgctactatgat |
5950874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University