View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2867_low_14 (Length: 259)
Name: NF2867_low_14
Description: NF2867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2867_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 12 - 244
Target Start/End: Complemental strand, 376384 - 376156
Alignment:
| Q |
12 |
atgaatgattaaggacgttacaacaatcctcatattgaaatccttaacaaatctatcactaaaatctccatcatcagcaaagcttcttctgcatggcagt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
376384 |
atgaatgattaaggacgttacaacaatcctcatattgaaatccttaacaaatctatcactaaaatctccatcatcagcaaagcttcttctgcatggcagt |
376285 |
T |
|
| Q |
112 |
tctttccttctcctgcaaaaacatgtccaatttggatataaattaagcttttcaatttcattgtagtaatcattggattaaatttaaacgaaacaaatta |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
376284 |
tctttccttctcctgcaaaaacatgtccaatttggatataaattaagcttttcaatttcattgtagtaatcattggattaaatttaaacgaaaca----a |
376189 |
T |
|
| Q |
212 |
aagaaattaattaattaggagagttgagaagaa |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
376188 |
aagaaattaattaattaggagagttgagaagaa |
376156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University