View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2869_high_5 (Length: 310)
Name: NF2869_high_5
Description: NF2869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2869_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 16 - 295
Target Start/End: Complemental strand, 229817 - 229539
Alignment:
| Q |
16 |
gatgatgtaagttcacttctctctacttgatccctatttattattagcttttaatattggacttaacacattccttacaaaatcaacgtttaccatgtca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
229817 |
gatgatgtaagttcacttctctctacttgatcactatttattattagcttttaatattggacttaacatat-ccttacaaaatcaacgtttaccatgtca |
229719 |
T |
 |
| Q |
116 |
tattaatattttttatattagatctaactcattatttataaatcggtatataacatgatgcgatgcgtgcatctctttgtaaaggtcttggtattttcaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
229718 |
tattaatattttttatattagatctaactcattatttataaatcggtatataacatgatgcgatgcgtgcatctctttgtaaaggtcttggtattttcaa |
229619 |
T |
 |
| Q |
216 |
tactaataaggttgatccccatatcatacacaaccctttagtttgactcatatcaaagctttatttcgagatcaaatatt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
229618 |
tactaataaggttgatccccatatcatacacaaccctttagtttgactcatatcaaagctttatttcgagatcaaatatt |
229539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University