View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2869_low_7 (Length: 243)
Name: NF2869_low_7
Description: NF2869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2869_low_7 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 42 - 243
Target Start/End: Complemental strand, 37975886 - 37975684
Alignment:
| Q |
42 |
ccataacaccacaagtcacaacatcatagcaaaatcaa--gtcttttggagctgcaagttagtaacaacattaaaatataaatttgtgaaattttggatc |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37975886 |
ccataacaccacaagtcacaacatcatagcaaaatcaatagtcttttggagctgcaagttagtaacaacattaaaatataaatttgtgaaattttggatc |
37975787 |
T |
|
| Q |
140 |
aaatattgtaaaccatcccacaatcccgtcatctctcatacttgtctcgccttagcatatcccaagaacaagtatcaatcgttctcatagctagtttgtt |
239 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37975786 |
aaatattgtaaaccatcc-acaatcccgtcatctctcatacttgtctcgccttagcatatcccaagaacaagtatcaatcgttctcatagctagtttgtt |
37975688 |
T |
|
| Q |
240 |
taac |
243 |
Q |
| |
|
|||| |
|
|
| T |
37975687 |
taac |
37975684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University