View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2870-Insertion-4 (Length: 102)
Name: NF2870-Insertion-4
Description: NF2870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2870-Insertion-4 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 70; Significance: 4e-32; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 4e-32
Query Start/End: Original strand, 8 - 102
Target Start/End: Complemental strand, 64183 - 64083
Alignment:
| Q |
8 |
gaaattttgtccccattgttgtttttctatatgtatgttaat------caacgtttggtcactactaagaagttgacattataccaatgaaatgagctgt |
101 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
64183 |
gaaattttgtccccatttttgtttttctatatgtatgttaatgttaatcaacgtttggtcactactaagaagttgacattgtaccaatgaaatgagctgt |
64084 |
T |
|
| Q |
102 |
t |
102 |
Q |
| |
|
| |
|
|
| T |
64083 |
t |
64083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University