View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2870_high_19 (Length: 328)
Name: NF2870_high_19
Description: NF2870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2870_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 6027206 - 6026937
Alignment:
| Q |
1 |
acaagatttttgcttcagccgttaaagaacttccacagcgcacgttagcaaccatagcccaaacgcgaaaaaagaagaagaatcactttttt-aatcgat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6027206 |
acaagatttttgcttcagccgttaaagaacttccacggcgcacgttagcaaccatagcccaaacgcgaaaaaagaagaagaatcactttttttaatcgat |
6027107 |
T |
|
| Q |
100 |
tcttcaaacttttttccttccaatatcaattaacatcccactcatcagaactctctggttcaggaatcttattcaaatcaactctctcagcaaaatcacc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6027106 |
tcttcaaacttttttccttccaatatcaattaacatcccactcatcagaactctctggttcaggaatcttattcaaatcaactctctcagcaaaatcacc |
6027007 |
T |
|
| Q |
200 |
agaaccatcaccttcaagcaactccggaaccggcataacacgatgatgctggttccggttatgctgaagg |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6027006 |
agaaccatcaccttcaagcaactccggaaccggcataacacgatgatgctggttccggttatgctgaagg |
6026937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University