View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2872_low_16 (Length: 235)
Name: NF2872_low_16
Description: NF2872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2872_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 221
Target Start/End: Original strand, 55523222 - 55523439
Alignment:
| Q |
4 |
agcaaaggttcaaagaaatggtagcaagcaaaggtttagagtttgctcagtctgaaatcaatgacttgaattgggaaagcactttctttttgcgccacct |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
55523222 |
agcaaaggttcaaagaaatggtagcaagcaaaggtttagagtttgctcagtctgaaattaatgacttggattgggaaagcactttctttttgcgccacct |
55523321 |
T |
 |
| Q |
104 |
tcctaactctaacatatcagagatccctgatcttgatcatgactacaggtcattatttattctcaatataaatcatgcacgtctcttattttaaattgcg |
203 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
55523322 |
tcctaactttaacatatcagagatccctgatcttgatcatgactacaggtcattatttattctcaatataaatcacgcacgtctcttattttaaattgcg |
55523421 |
T |
 |
| Q |
204 |
gtttgaaccttcatattg |
221 |
Q |
| |
|
||||||||||| |||||| |
|
|
| T |
55523422 |
gtttgaacctttatattg |
55523439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 6 - 155
Target Start/End: Original strand, 8926477 - 8926626
Alignment:
| Q |
6 |
caaaggttcaaagaaatggtagcaagcaaaggtttagagtttgctcagtctgaaatcaatgacttgaattgggaaagcactttctttttgcgccaccttc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| || |||||| ||||| ||||| ||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
8926477 |
caaaggttcaaagaaatggtagcaagcaaaggtttggagtgtgttcagtcagaaataaatgatttggattgggaaagcactttctttttgcgccatcttc |
8926576 |
T |
 |
| Q |
106 |
ctaactctaacatatcagagatccctgatcttgatcatgactacaggtca |
155 |
Q |
| |
|
|| ||||| || ||||||||||| ||||||||| | || ||||||||| |
|
|
| T |
8926577 |
cttcttctaatatttcagagatcccagatcttgatgaagattacaggtca |
8926626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University