View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2872_low_18 (Length: 216)
Name: NF2872_low_18
Description: NF2872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2872_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 14 - 200
Target Start/End: Complemental strand, 10928266 - 10928082
Alignment:
| Q |
14 |
ataatactcaaggtaacactagtttcataatattattaggggatgttgggggaatctgtcagttgtacccaagcctctaggaagaagacaatatcatgga |
113 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10928266 |
ataatactctaggtgacactagtttcataatattattaggggatgttgggggaatctgtcagttgtacccaagcctctaggaaaaagacaatatcatgga |
10928167 |
T |
|
| Q |
114 |
cccaactttttaacgtgccaaataatagggacagaacaattgcagatgcttctggatcatatatcagttcagagtatccattacaaa |
200 |
Q |
| |
|
||||||||||||| |||||||||| ||| |||| ||||| ||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
10928166 |
cccaactttttaatgtgccaaatagtagagacaaaacaaatgcagatgcttctggatcatatatc--ttcagagtatccgttacaaa |
10928082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University