View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2872_low_19 (Length: 205)
Name: NF2872_low_19
Description: NF2872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2872_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 24 - 188
Target Start/End: Complemental strand, 3842715 - 3842547
Alignment:
| Q |
24 |
ggatctcattgattcata--gagtttcagtttcaatttctgatgccctaagttttgtgccttttctccaaattacccactattttcgggtattgtcttta |
121 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
3842715 |
ggatctcattgattcatacagagtttcagtttcaatttctgatgccctaagttttgagccttttgtccaaactacccactattttcgggtattgtcttta |
3842616 |
T |
 |
| Q |
122 |
cttactacatgga--nnnnnnnnnnctcgtttattttcggtatttcttcatgctaacaacccttctgtg |
188 |
Q |
| |
|
||||||||||||| || ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3842615 |
cttactacatggattttttttttttcttgtttatttttggtatttcttcatgctaacaacccttctgtg |
3842547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University