View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2872_low_20 (Length: 203)
Name: NF2872_low_20
Description: NF2872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2872_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 16 - 128
Target Start/End: Original strand, 41529500 - 41529612
Alignment:
| Q |
16 |
aatattgtcggtattttataatatagagaaattaaggacagagaattcaatacaaaaggaaattgcaaaaagagggttcaattgaggatttccatagttt |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41529500 |
aatattgtcggcattttataatatagagaaattaaggacagagaattcaatacaaaaggaaattgcaaaaagagggttcaattgaggatttccatagttt |
41529599 |
T |
|
| Q |
116 |
aggttcatacaaa |
128 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41529600 |
aggttcatacaaa |
41529612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 128 - 186
Target Start/End: Original strand, 41531587 - 41531645
Alignment:
| Q |
128 |
attaactaaagcacattttgaaatatttccttatataccacatttgatgtgacgtttgt |
186 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41531587 |
attaacttaaacacattttgaaatatttccttatataccacatttgatgtgacgtttgt |
41531645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 114 - 186
Target Start/End: Complemental strand, 43586854 - 43586783
Alignment:
| Q |
114 |
ttaggttcatacaaattaactaaagcacattttgaaatatttccttatataccacatttgatgtgacgtttgt |
186 |
Q |
| |
|
||||||||||| ||| |||||||| ||||||||||||||||| || ||||| | ||||||||||| |||||| |
|
|
| T |
43586854 |
ttaggttcatatgaataaactaaagtacattttgaaatatttctttttatacta-atttgatgtgatgtttgt |
43586783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University