View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2872_low_9 (Length: 291)
Name: NF2872_low_9
Description: NF2872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2872_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 5 - 276
Target Start/End: Original strand, 55377297 - 55377577
Alignment:
| Q |
5 |
gagaagcatagggccaaggtggtgagttttcagattcagcaggagcaacatcaaatttgaaatcaaggagtgccgttgaagaagacaaaatacagtgtct |
104 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55377297 |
gagaggcatagggccaaggtggtgagttttcagattcagcaggagcaacatcaaatttgaaatcaaggagtgccgttgaagaagacaaaatacagtgtct |
55377396 |
T |
 |
| Q |
105 |
tgttgtagttgttttgggtgctgcatcaaaaagaaaagagtgaggtgagaaatgagnnnnnnnnnnnnnnnnnnngagaattgtttatgcatacactgaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
55377397 |
tgttgtagttgttttgggtgctgcatcaaaaagaaaagagtgaggtgagaaatgagaatataatataatataatagagaattgtttatgcatacactgaa |
55377496 |
T |
 |
| Q |
205 |
gaagaaaga---------gatgatgatgatgatggcggtgggtagggatcctgatgaaagtgtctgggttgcagatgaatt |
276 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
55377497 |
gaagaaagagatgatgatgatgatgatgatgatgccggtgggtagggattctgatgaaagtgtctgggttgcagatgaatt |
55377577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University