View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2873_high_15 (Length: 311)
Name: NF2873_high_15
Description: NF2873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2873_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 282; Significance: 1e-158; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 38816459 - 38816178
Alignment:
| Q |
1 |
tctaaagatgaaggaggaatgcttgggtgggtgagaaagggacaaatggtatgctgttgtttaggtttaattaaaccttgttcttagggttttacatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38816459 |
tctaaagatgaaggaggaatgcttgggtgggtgagaaagggacaaatggtatgctgttgtttaggtttaattaaaccttgttcttagggttttacatttt |
38816360 |
T |
|
| Q |
101 |
gtctagattttgcagttggctactttttgtggttacagttggtatacatcacggccttatgtaaattaaactgactttgtctgttagagaagggtatata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38816359 |
gtctagattttgcagttggctactttttgtggttacagttggtatacatcacggccttatgtaaattaaactgactttgtctgttagagaagggtatata |
38816260 |
T |
|
| Q |
201 |
gttgtatgaggtttctttgggtaggtgagaaattgaggttcaaaggatacaatataccttttcttgcattttctttcactga |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38816259 |
gttgtatgaggtttctttgggtaggtgagaaattgaggttcaaaggatacaatataccttttcttgcattttctttcactga |
38816178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 38821870 - 38821782
Alignment:
| Q |
1 |
tctaaagatgaaggaggaatgcttgggtgggtgagaaagggacaaatggtatgctgttgtttaggtttaattaaaccttgttcttagggttt |
92 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||| || ||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
38821870 |
tctaaagaagaaggaggaaggcttgggtgggtgagaaagggacaaatggta---tgatgtttagatttgcttaaatcttgttcttagggttt |
38821782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University