View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2873_high_16 (Length: 310)
Name: NF2873_high_16
Description: NF2873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2873_high_16 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 30 - 310
Target Start/End: Complemental strand, 29405152 - 29404872
Alignment:
| Q |
30 |
gacacgttggtggaattcttgcgtgatagttgtggtcgtagatttcctccgccagaattctcaggggaatctgccgtgaaccgagttgagctcccacgag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29405152 |
gacacgttggtggaattcttgcgtgatagttgtggtcgtagatttcctccgccagaattctcagaggaatctgccgtgaaccgagttgagctcccacgag |
29405053 |
T |
|
| Q |
130 |
tgaattttggcctgctagctggagcattggattcatctgatggatcgaggtcatctacttggtgtgttgacatgtctgagtcgtaatgagtttggactcg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29405052 |
tgaattttggcctgctagctggagcattggattcatctgatggatcgagctcatctacttggtgtgttgacatgtctgagtcgtaatgagtttggactcg |
29404953 |
T |
|
| Q |
230 |
aactgaattgcgacgaccgaattgtgaaaagcttctgctgtttggattttggatagggatgtctgacgttggaatgggaat |
310 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
29404952 |
aactgagttgcgacgaccgaattgtgaaaagcttctgctgtttggattttggatagggatgtcggatgttggaatgggaat |
29404872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 195 - 304
Target Start/End: Original strand, 19911822 - 19911934
Alignment:
| Q |
195 |
gttgacatgtctgagtc---gtaatgagtttggactcgaactgaattgcgacgaccgaattgtgaaaagcttctgctgtttggattttggatagggatgt |
291 |
Q |
| |
|
||||||||||||||||| || |||||||||| ||| ||||| ||||||||||||||||| ||||| ||||| || || |||||||||||||| || | |
|
|
| T |
19911822 |
gttgacatgtctgagtcatcgtggtgagtttggattcggactgagttgcgacgaccgaattgagaaaaacttctactattaggattttggataggaatat |
19911921 |
T |
|
| Q |
292 |
ctgacgttggaat |
304 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
19911922 |
ctgaagttggaat |
19911934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University