View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2873_high_17 (Length: 305)
Name: NF2873_high_17
Description: NF2873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2873_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 143 - 281
Target Start/End: Original strand, 51433585 - 51433723
Alignment:
| Q |
143 |
ataattttacttaacttttagcctaactctagattactaaagtataggattaaaatcaaaaatacatatatgatatgagttatgagagaattaccagtta |
242 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51433585 |
ataattttacttaactttaagccgaactctagattactaaagtataggattaaaaccaaaaatacatatatgatatgagttatgagagaattaccagtta |
51433684 |
T |
|
| Q |
243 |
gcagcagagaaatgtttcacggactcttgatcactgatg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51433685 |
gcagcagagaaatgtttcacggactcttgatcactgatg |
51433723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 30 - 71
Target Start/End: Original strand, 51433507 - 51433548
Alignment:
| Q |
30 |
aataatggacaaaaaacacaatcaaatatggaaaggaaaaca |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51433507 |
aataatggacaaaaaacacaatcaaatatggaaaggaaaaca |
51433548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 90 - 120
Target Start/End: Original strand, 51433557 - 51433587
Alignment:
| Q |
90 |
gtataaatagaaatatttagcaagacacata |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
51433557 |
gtataaatagaaatatttagcaagacacata |
51433587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University