View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2874_high_1 (Length: 578)
Name: NF2874_high_1
Description: NF2874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2874_high_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 246; Significance: 1e-136; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 261 - 550
Target Start/End: Original strand, 19607106 - 19607395
Alignment:
| Q |
261 |
gtgtcgaaccggtgatgtcattgaggaagtcatcagatgaggcggcgcaaccggtggtgtggcatgtgtcttgaccgttggtggagaaggctttagttga |
360 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
19607106 |
gtgtggaaccggtgatgtcattgaggaagtcatcagatgaggcggcgcaaccggtggtgtggcatgtggcttgaccgttggtggagagggctttagttga |
19607205 |
T |
|
| Q |
361 |
tggtacggttttttatgaaactcatcatagaaagccggtgagcaagttaatccgtaaatatacttcagttcctcatgatttagattgggctcggaaaggt |
460 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19607206 |
tggtacggttttttatgaaactcatcataggaagccgatgagcaagttaatccgtaaatatacttcagttcctcatgatttagattgggctcggaaaggt |
19607305 |
T |
|
| Q |
461 |
gtgattgtctcagtgttgaatggagaagcaataccgattattcagacttgtaaagaggatgcaggttttgatgacttagatattattcca |
550 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||| ||| ||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19607306 |
gtgattgtctcagtgttgaacggagaagcaataccggttattcaaactcgtatagaggatgcgggttttgatgacttagatattattcca |
19607395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 101; E-Value: 9e-50
Query Start/End: Original strand, 63 - 193
Target Start/End: Original strand, 19606911 - 19607038
Alignment:
| Q |
63 |
acagtaatgaaggaggagatttttaggactggtgagggagaaaagattgccgagagaatgggagaagaaggtgagggagaaaaaagagtgagtgggggaa |
162 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19606911 |
acagtaatgaaggaagatatttttaggactggtgagggagaaaagattcccgagagaatgggagaa---ggtgagggagaaaaaagagtgagtgggggaa |
19607007 |
T |
|
| Q |
163 |
acaagggagcaggagggggcaggtctttgta |
193 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |
|
|
| T |
19607008 |
acaagggagcaggagggggcaggtctctgta |
19607038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University