View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2874_high_12 (Length: 263)
Name: NF2874_high_12
Description: NF2874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2874_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 14 - 246
Target Start/End: Complemental strand, 29217467 - 29217242
Alignment:
| Q |
14 |
agacaagtccaatgtgttattcagcctaattagcaccatcttctaattgactaagtatagtcacaaaatcaatctcaaacgtcacttatttttgtttgca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29217467 |
agacaagtccaatgtgttattcagcctaattagcaccatcttctaattgactaagtatagtcacaaaatcaatctcaaacgtcacttatttttgtttgca |
29217368 |
T |
|
| Q |
114 |
tgcctaagttata-ataatattaaaattactaagg-tttacacctcatgagctatacgaggtcgaatagtcgcatgccgtatgttatttgctaattatgt |
211 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29217367 |
tgcctaagttatatataatattaaaattactaaggttttacacctcatgagctat---------aatagtcgcatgccgtatgttatttgctaattatgt |
29217277 |
T |
|
| Q |
212 |
ttactcacgttgcggtctctctcaaatggtgtaaa |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
29217276 |
ttactcacgttgcggtctctctcaaatggtgtaaa |
29217242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University