View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2874_low_9 (Length: 304)
Name: NF2874_low_9
Description: NF2874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2874_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 21 - 289
Target Start/End: Complemental strand, 34816508 - 34816242
Alignment:
| Q |
21 |
gaaccaatcctctcccccgacccccattacccacaccacacaagtccttccaccacaatgaagctagactcaatctgtcaaaattagataaatccgagtt |
120 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34816508 |
gaaccaatcctctcccccaacccccattacccacaccacacaagtccttccaccacaatgaagctagactcaatctgtcaaaattagataaatccgagtt |
34816409 |
T |
 |
| Q |
121 |
agccacaatactaactttgtacttggcatataaggcaccttttgcaatgagaatcacccttgcagtagtactctcattaatgatattgggatagaaccca |
220 |
Q |
| |
|
||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
34816408 |
agccacaataccaactttgtacttggc--atacggcaccttttgcaatgagaatcacccttgcagcagtactctcattaatgatgttgggatagaaccca |
34816311 |
T |
 |
| Q |
221 |
aaatagaattgatgtgaacgactctaccactgagactaacatatatatcctcaacgatcgcaatttgat |
289 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34816310 |
aaatagaattgatgtgaacaactctaccactgagactaacatatgtatcctcaacgatcgcaatttgat |
34816242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University