View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2875_high_4 (Length: 436)
Name: NF2875_high_4
Description: NF2875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2875_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 187 - 320
Target Start/End: Complemental strand, 31485470 - 31485337
Alignment:
| Q |
187 |
gtgatgtagaagtataaattggaggagtacaaagaagggaggaatctgcttgatagatgtgataaattgttgaacagcatagctgagataacagccgcga |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31485470 |
gtgatgtagaagtataaattggaggagtacaaagaagggaggaatctgcttgatagatgtgataaattgttgaacagcatagctgagataacagccgcga |
31485371 |
T |
|
| Q |
287 |
acgagttacaaccgagtccagtatcggttcttga |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31485370 |
acgagttacaaccgagtccagtatcggttcttga |
31485337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 314 - 406
Target Start/End: Original strand, 31485761 - 31485853
Alignment:
| Q |
314 |
ttcttgaacttatcttcggcgaattaaccggggacactcttctagaatcaacaccctcattactaagcctcctccgcgtctccacgttcggga |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||| |
|
|
| T |
31485761 |
ttcttgaacttatcttcggcgaattaaccggggacactcttctagaatcaacaccttcattactaagcctcctccgtgtttccacgttcggga |
31485853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University