View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2876_high_6 (Length: 251)
Name: NF2876_high_6
Description: NF2876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2876_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 242
Target Start/End: Complemental strand, 39710751 - 39710526
Alignment:
| Q |
17 |
atattatggttgaacaatataaatatcagacatctcaatgtcacctatgtgctaccagccatccaaacagcagcagctgtttcgcatgttcaataaccgc |
116 |
Q |
| |
|
|||||||||||||||| ||||||| ||| || |||||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
39710751 |
atattatggttgaacagtataaatgtcacacgactcaatgtcacctatgtgctaccagccatccaaagagcagcagctgtttcacacgttcaataaccgc |
39710652 |
T |
 |
| Q |
117 |
ctgacagttttcagaaacatttcttcaaatttttatgttctcacttttcgacaaattccacgttgcaaataattcaaacttcgtatgtgacaaacaagtt |
216 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39710651 |
ctgatagttttcagaaacatttcttcaaatttttatgttctcacttttccacaaattccacgttgcaaataattcaaacttcgtatgtgacaaacaagtt |
39710552 |
T |
 |
| Q |
217 |
ctgcgctaaagcaaatataatctctg |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
39710551 |
ctgcgctaaagcaaatataatctctg |
39710526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 87 - 177
Target Start/End: Original strand, 15662354 - 15662444
Alignment:
| Q |
87 |
cagcagctgtttcgcatgttcaataaccgcctgacagttttcagaaacatttcttcaaatttttatgttctcacttttcgacaaattccac |
177 |
Q |
| |
|
|||||| ||||||| ||||||||| ||||| ||||||| ||| ||| ||||| | ||||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
15662354 |
cagcagttgtttcggatgttcaatcaccgcatgacagtgttcggaaccatttttccaaatttttatgttccgacttttccacaaactccac |
15662444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University