View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2876_high_9 (Length: 239)
Name: NF2876_high_9
Description: NF2876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2876_high_9 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 21 - 239
Target Start/End: Complemental strand, 34882769 - 34882551
Alignment:
| Q |
21 |
aaacgagtacaaaggatttaagatgctttaagggacgaagcaaatgcttatttataggccaacggtcgagcttcaatggcatataaggcttcattgcaga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34882769 |
aaacgagtacaaaggatttaagatgctttaagggacgaagcaaatgcttatttataggccaagggtcgagcttcaatggcatataaggcttcattgcaga |
34882670 |
T |
 |
| Q |
121 |
tcaatgcatcaaacccttcaaatcatgcaaagtgtaaccaatgttttcttaaaattaacaagcattacgattgtgttaaacaacactggttcctataagg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34882669 |
tcaatgcatcaaacccttcaaatcatgcaaagtgtaaccaatgttttcttaaaattcacaagcattacgattgtgttaaacaacactggttcctataagg |
34882570 |
T |
 |
| Q |
221 |
tgcttgattgtcatctttt |
239 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34882569 |
tgcttgattgtcatctttt |
34882551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 110 - 159
Target Start/End: Original strand, 33044815 - 33044865
Alignment:
| Q |
110 |
ttcattgcagatcaatgcatcaaa-cccttcaaatcatgcaaagtgtaacc |
159 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||| |||||||||| |
|
|
| T |
33044815 |
ttcattgcagatcaatgcttcaaaacccttcaaatcatgcgaagtgtaacc |
33044865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University