View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2876_low_13 (Length: 237)
Name: NF2876_low_13
Description: NF2876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2876_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 41389292 - 41389407
Alignment:
| Q |
1 |
aatcaggccctccattttttgtcctaatacatgtccatgtattggattatatatgaaattcatcctcttgtacgttaaacaggttttctaaatttgatat |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41389292 |
aatcaggccctccattttttgtccaaatacatgtccatgtattggattatatatgaaattcatcctcttgtacgttaaacaggttttctaaatttgatat |
41389391 |
T |
 |
| Q |
101 |
ttgatgcacaaatatg |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
41389392 |
ttgatgcacaaatatg |
41389407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 176 - 232
Target Start/End: Original strand, 41389467 - 41389523
Alignment:
| Q |
176 |
aaaaatggactatgtataatgtagtagtactataaaactttcatcatgatgatgtcc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41389467 |
aaaaatggactatgtataatgtagtagtactataaaactttcatcatgatgaggtcc |
41389523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University