View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2877_high_10 (Length: 269)
Name: NF2877_high_10
Description: NF2877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2877_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 22 - 240
Target Start/End: Original strand, 19855369 - 19855586
Alignment:
| Q |
22 |
gtaaggatcacaaattcacaactaaatcttttcaagtaagaagattaatatttggtattccatgacaaatttggcaaatttcttaataggaaaatggtat |
121 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19855369 |
gtaaggatcacaagttcacagctaaatcttttcaagtaagaagattaatatttggtattccatgacaaatttggcaaatttcttaataggaaaattgtat |
19855468 |
T |
 |
| Q |
122 |
cggtttaccattagacac--aaatatcacaagatgattcctacttgaaaatttggtattacttgttttcagctatagtgattcttagaaaagttactagt |
219 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19855469 |
cggtttaccaatagacacaaaaatatcacaa---gattcctacttgaaaatttggtattacttgttttcagctatagtgattcttagaaaagttactagt |
19855565 |
T |
 |
| Q |
220 |
tactccatatgcaccaaactt |
240 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
19855566 |
tactccatatgcaccaaactt |
19855586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University