View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2877_low_17 (Length: 243)
Name: NF2877_low_17
Description: NF2877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2877_low_17 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 243
Target Start/End: Complemental strand, 3490065 - 3489835
Alignment:
| Q |
16 |
ctttcagctatcctaggtattaaacttcttttcttttcttcaagtgcaagcttcatcccatatttgcaaaaatcatgacaggaacctattgaatctcgaa |
115 |
Q |
| |
|
||||| |||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
3490065 |
ctttcggctatccttggtattaaactttttttcttttcttcaagtgcaagcttcatcccatatttgcaaaaatcatgacaggaacctgtcgaatctcgaa |
3489966 |
T |
 |
| Q |
116 |
gataatgaggaacaagttttccttcattatttccaggactagtttttccagaagagtgtcttcttcttaattcgtcgacgcg---cggcatagttactcc |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| | | || || || |||||||| ||| |
|
|
| T |
3489965 |
gataatgaggaacaagtttttcttcattatttccaggactagtttttccagaagtgtgtcttcttcttaatacaccaacacgtgtcgacatagttagtcc |
3489866 |
T |
 |
| Q |
213 |
agaaatcactggtccatcaacacattcctct |
243 |
Q |
| |
|
||||||||||||| |||||||||||| |||| |
|
|
| T |
3489865 |
agaaatcactggtacatcaacacatttctct |
3489835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University