View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2878_high_5 (Length: 240)
Name: NF2878_high_5
Description: NF2878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2878_high_5 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 15245167 - 15244945
Alignment:
| Q |
18 |
aattgttggtcaaagaattgatttttggccacactttgtgtttggtgaaattgaatgtttcctttttgcatcttcccaccatggacggtaaaccaaggta |
117 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
15245167 |
aattgttggtccaagaattgacttttggccacactttgtctttggtgaaattgaatgtttcctttttgcatcttcctaccatggacggtaagccaaggta |
15245068 |
T |
 |
| Q |
118 |
tttaacgatagccaaaattgcttgcacaactaaaatattagcgattgaattttgcatccgttgagggacattttgactttggaaggttggtcgcttataa |
217 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15245067 |
tttaacgatagccaaaattgcttgcgcaactaaaatattagtgattgaattttgcatccgttgagggacattttgactttggaaggttggtcgcttataa |
15244968 |
T |
 |
| Q |
218 |
ataatagtttcattgtgacatat |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
15244967 |
ataatagtttcattgtgacatat |
15244945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University